KEGG   Candidatus Gullanella endobia (Ferrisia virgata): FVIR_GE0516
Entry
FVIR_GE0516       gene      T04502                                 

Gene name
sucB
Definition
(GenBank) pseudogene
Organism
ged  Candidatus Gullanella endobia (Ferrisia virgata)
SSDB
Position
I:916468..916817
NT seq 350 nt   +upstreamnt  +downstreamnt
aaatatatcctgataatctatctacgaaaatataaacacataatagaatacctgctagaa
gcaaaaatagcaaatagcaaaactatattgactacttttaatacaattaaaatgttatat
atctaatcatagatatgtataaatagcatattttcatgtctaaaaagcgctatgacatta
atttaggttttatgttcttctatactaagagtatagcagcaattttaaaagatattttaa
ataagtaaatatatactaattttaaagatatgatttattatagctgttatgacgtcagca
tcgcattatctttgtttcgtggtctaataatattagtattgaataatgtt

DBGET integrated database retrieval system