KEGG   Candidatus Gullanella endobia (Ferrisia virgata): FVIR_GE0521
Entry
FVIR_GE0521       gene      T04502                                 

Gene name
tolB
Definition
(GenBank) pseudogene
Organism
ged  Candidatus Gullanella endobia (Ferrisia virgata)
SSDB
Position
I:925588..926827
NT seq 1240 nt   +upstreamnt  +downstreamnt
catgcgaaaatgcgtactgaaatcattcaaggaatggatatagataactaagagcctatc
ggtgtagttttatttaaataggatctagtactgcatccaaaagatgttaatagcataatc
tctgtcgacctgcgtaatagcggtaaattcaatcctattgatatatcttatttttcaaag
aaactaagtattacttcagaagtagtattaaatgtttagaaagagcttagcatcgatatc
gtagtagtagggaagacaaaatcaatttccgacgatagctatgcggtttcttattaatta
gtagatacctttgataaccaaggaatcgttttggcattaaatcagtttaatgttatacaa
aatagctaaattatactgctcatactgttaacgataaatcctttgaaaaactcactgata
ttaagaaagtgctttccgtgctcgtattatttatattgttcaaaccaatagtggtcaata
tttatatgaactgcgcatttcggattataatagttttaaccagattctggtacatcgttc
atttcagtcactgatgtcgtcgtcagtttgattacttaatggaactaggctttcttatat
cacctttgaaagcggtcaatcagcgctatttattcaagcattagataatgaaaaaaaatc
aagacatttcaagtttttctcaacataatagtgcttcatttttcatctaatggtattaaa
ttggctttcatactctcaaagagaggtaatataaatatatacgtaatggatttaaattca
ggtcaagtgaattagtaactgaagattgaagtgataatacgtaattgagctggtttccag
ataattttacactagcatatacttccaattaaagtgatcgtccttaagtgtataaaatta
atattaataacgatatattgcaatttctgtcttggaataggttatcagaatcaaaattcg
aatgttggccaagatgataaatttttagtaatgattaacattaataataacatacagcat
tttactaaactagattcgttaacaaatactgttacagtattgacagatacgttttctaga
taaaactcctagtatttctcctaatagaacaatggttatctacagtactacgcaaggatt
tagttctatgttaaagttaatttctattgatgaatgtttcaaatcaatttttttcagtaa
ccaatgggcaagttaaaatcctgtatgatctccatattta

DBGET integrated database retrieval system