KEGG   Gallus gallus (chicken): 395256
Entry
395256            CDS       T01006                                 

Gene name
MEPE
Definition
(RefSeq) ovocleidin-116 precursor
Organism
gga  Gallus gallus (chicken)
SSDB
Other DBs
NCBI-GeneID: 395256
NCBI-ProteinID: NP_989900
CGNC: 49233
Ensembl: ENSGALG00000010927
UniProt: F1NSM7
Position
4
AA seq 743 aa
MRATLFCLCLCLLGTVLPTPVSLPARARGNCPGQHQILLKGCNTKHGFYIFQYIYSHLMQ
KNQTQVKKEEGDHQGTIHGHWLGKVDGEAPGQGVGSSHVPEDKDSPKPHSHITPASKGEG
RALRPGIGDSNSVYPTSTSVEGSGDMGSILLGEIINGEDGLPHSTHPGGPHGDGDGGNGV
LVDGAVTAGRERASGSKGAGSEGGSHATVPDQGQAGTMGTGDSAITSVTDSAITSVTKKE
DVHVDTEGIDEFAYIPDVDAVTITRGQDGETHISPEDEVKIFIGRANIQVGENDSSVGSA
GATSEANVIPTVVTVRPQGHPEESATMATLHHGDSVTSRPVGHPSVGNSGDGATEIHSGQ
ELEAPSPWESTGGDATVTMAVGVQSGKGRSGQRALGKHSLPATMTTRGGRGTASSGLTTG
DCSTAASTPSRKGSHVVTAGQGESGEVGTAGPERQRSRVQQEVAPARGVVGGMVVPEGHR
ARVQQEVAPSRGVVGGMVVPEGHRARTQPEVASAPSTVGKAAPERHRNRAQQEVAPVPSM
VVETVAPERHRARVRPESARLGQAARPEVAPAPSTGGRIVAPGGHRARVWPGAAPAPGVV
GVARPAPSKAYNGDKRVAIGKSTDVPRDPWVWGSAHPQAQHTRGSTVAGGFAHLHRGQRL
GGLTEMEHSRQVEQVRHADRLRLHERAVYGLSGVGGPLQPPAVHTDPWSADSSQSSEGRW
GSHSDSREEDGEVRGYPYGRQSL
NT seq 2232 nt   +upstreamnt  +downstreamnt
atgcgcgcaaccctcttctgcctctgcctctgccttctgggcaccgtgctgcccacgccc
gtgtcacttccagccagggcaagaggaaactgccctggacagcaccagatactgctgaaa
ggttgcaataccaaacatggcttctacatcttccagtacatttactcccacctcatgcag
aaaaatcagacacaggtcaagaaagaagaaggtgaccaccagggcacaatccatggccac
tggctgggtaaggtggatggggaggccccagggcaaggtgttggaagcagccatgtgccg
gaggacaaggacagccccaagccccacagccacatcactccagcaagcaaaggggaaggc
cgtgctctgcgccccggtattggtgacagcaacagtgtgtatcccacctcaaccagtgtg
gaaggcagtggcgacatgggttcgattttgctgggggagatcatcaatggcgaagatggc
ctcccccacagcacccaccctggtggacctcatggagatggcgatggtggtaacggtgtc
ctggtggatggggctgtgactgcagggagggagagggcctctggttccaaaggggctggg
agtgagggtggtagccatgccactgtgcccgaccaagggcaagcaggcaccatggggaca
ggagactctgccatcacctctgtcacagactctgccatcacctctgtcaccaagaaggag
gatgtccatgtggacacagaaggcatagatgagttcgcatacatccctgatgtagatgct
gtcaccatcacacgggggcaggacggtgaaacacatatctctccggaggatgaggtgaag
atcttcattggaagagccaacatccaagtgggtgagaatgacagcagtgtgggcagcgct
ggtgctaccagtgaggccaatgtcatccctacagtggtgaccgtcaggcctcagggacac
cctgaggaatcagccaccatggccaccctgcatcatggggacagtgtcaccagcaggcct
gtgggccacccttctgtaggaaacagtggggatggtgccactgaaatccacagcggacaa
gagctggaggcccctagcccttgggagagcactggtggcgatgccactgtcaccatggca
gttggtgtccaaagtggcaaggggagaagcggacagagggcactggggaagcatagcctt
ccagccaccatgacaactcggggtggcagaggaacagcctcctcagggctgactacaggg
gactgcagcactgctgccagcacaccgtccaggaaagggagccatgtggtcactgcaggg
caaggagagagcggtgaggtggggacagcaggcccagagagacagaggtctagggtccag
caagaggtggcaccagcacgtggtgtggtgggaggaatggtggtccctgaggggcacagg
gctagagtccagcaagaggtggcaccatcacgtggtgtggtgggaggaatggtggttcct
gaggggcacagagccaggacccagccagaggtggcatcagcacccagcactgtggggaaa
gcagccccagagaggcacaggaacagggctcagcaagaagtagcaccagtgcccagcatg
gtggtggaaacagtggccccagagaggcacagggccagggtgcggccagagtcagccagg
ctgggacaagcagcgaggccagaggtggcaccagcacccagcacaggggggagaattgtg
gccccaggggggcaccgggccagggtttggccaggggcagcaccggcacctggagtggtg
ggggtggccaggccagctcccagcaaagcctataatggggacaaaagggttgccatagga
aagtccactgatgtgccaagggatccctgggtgtggggcagcgcccacccccaggcccag
cacaccaggggcagcacggtggcaggaggctttgcccacctgcacagagggcaaaggttg
gggggcctgacagagatggagcactccaggcaggtggagcaggtgaggcacgctgaccgg
ctgcgcctgcatgagcgggccgtgtatggcctcagcggggtgggcggccccctgcagcct
cccgcagtccacactgacccctggagcgccgacagcagccagtcttctgaggggcggtgg
ggcagccacagcgacagccgtgaggaggatggcgaggtcagagggtatccctacggccga
cagtccctctga

DBGET integrated database retrieval system