KEGG   Halanaerobium hydrogeniformans: Halsa_0507Help
Entry
Halsa_0507        gene      T01349                                 

Definition
(GenBank) pseudogene
Organism
has  Halanaerobium hydrogeniformans
SSDB OrthologParalogGene clusterGFIT
Position
complement(595665..597724)
Genome map
NT seq 2060 nt NT seq  +upstreamnt  +downstreamnt
atgaatatagaaaaattaaaagaaatcctattaaagagaaaagaaataatatttgcttat
cttttcggatcttttgctgaaaataaagaaaattcccttagcgatatagatttagctgtc
tatatagatcaaagtgaacctctccatctaaatcaaaaccaagatttgcatcaaaagaga
tactagcttcgcgtcggatggagcttctaactgcttcatatagattaaagttcaacctat
attactaggtcagtttacaagatgtttggcttttaagttttgctcctaatagtttaggat
acccttaatcttgaaggattgtccacaaatccattatctctcgcctctttgataggtctg
agaatacatttatccttatgatatttacgaagtatattaaagctaccattctgatcagca
ttaattaataggccctcgttagttttaaagagacctctggtaattcttctggatttatca
tagttacttttatttattttttccagatctactgaatagcggccaaatcgaatacggtca
tactaaagcttaccttgcgtaattaaaattaaaagctttagtacacccagaagtatagct
ttcatcaatttcaacaactttgataccttttagtttagctttgtattcaattaatttttt
taatctctggattggtatttggacaaaagatttaagcttgctgcattgtttaatattttt
tatatctctgattacaatagtttctacttgattttcaattgctaaatcaactattttgca
actagctttatggagataatcgctaatataatttcttctctttaatctcagatattttat
tcgtttagtatctctaattttactggtagctaactgcctcattctaatgctttgtagtct
ggcaatttctttattaaaataagaatttttggatttaatagttttaccattgataatata
acaatcaaaattgtttttaaatgttaaagtagccaaattatcaagacctagatctattgc
cattatgttagggttattattttcttttatttcctcggtcttatagataattaagagata
ccatcttttagaaatacggtcctgcttaatctttatctgctggacagcatctaaatctat
aatgctttgaactgcttcaggcagctcaaaattaaggaggccaaatcgaatacggtcata
ctaaagctttccttgcgtattataaattaaaagctttagtgaccttcacattatatttag
attgtatctttttagataaggataagagtaatttgttatctttaattctaacagctaaat
tggtaaaaattatttcacagggattactgttcatatgtttaaaattaggtgaccctggct
gccccttatatttttgaggattctttttataatctttgagagaattaaaaaaacttttcc
agtccttagctaactgctttaatgcctgctgtctgttatgggagtgaaggtagtcattat
gccagttatttttatatctagtttctaattcagtatagacagcttttacatctttattat
ttttaatctgataattgactgtattatataatttagagcaatgccaggctaattcattaa
ttattactaattgcttatggcttaatttaggcttgaatttaaatgataatcgcattgatt
tttcacctccatcctactataattatatcatacatatgtttgcttgtaaaagaaaaaatg
gaggtttgatttttatgaatagagacttaaataacaattatcattctgtttatagtctac
aatatcatttagttgtatcttctggtggtgctactattgagacaattaaaaagtatattg
aaaatcagaataaatagccaattcatctccacccaatgcatagcttggatggagttttct
tggcagttttagataaaaaacctgagagtggagttttgctaattaataagtccgatcaaa
aatgaagccgctttcatgaaaagacaatgcgagaatatctagattttttgccgatgtata
aagttcaggctaaatattta

DBGET integrated database retrieval system