KEGG   Hyperthermus butylicus: Hbut_0473Help
Entry
Hbut_0473         tRNA      T00468                                 

Definition
(GenBank) tRNA-Val
  KO
K14237  tRNA Val
Organism
hbu  Hyperthermus butylicus
Pathway
hbu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:hbu00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Hbut_0473
Non-coding RNAs [BR:hbu03100]
 Transfer RNA
  tRNA
   Hbut_0473
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
join(452831..452869,452904..452943)
Genome map
NT seq 79 nt NT seq  +upstreamnt  +downstreamnt
gggcccgtcgtctagcttggtaggatgcggggtacacaggaccccgtggtcccgggttca
aatcccggcgggcccacca

DBGET integrated database retrieval system