KEGG   Candidatus Hamiltonella defensa (Acyrthosiphon pisum): HDEF_0549Help
Entry
HDEF_0549         tRNA      T00911                                 

Definition
(GenBank) tRNA-His
  KO
K14226  tRNA His
Organism
hde  Candidatus Hamiltonella defensa (Acyrthosiphon pisum)
Pathway
hde00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:hde00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    HDEF_0549
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hde03100]
    HDEF_0549
Non-coding RNAs [BR:hde03100]
 Transfer RNA
  HDEF_0549
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
545966..546041
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
gtggctatagctcagttggtagagccctggattgtgattccagttgtcgtgggttcgagt
cccattagccacccca

DBGET integrated database retrieval system