KEGG   Helicobacter pylori F32: HPF32_0491Help
Entry
HPF32_0491        CDS       T01911                                 

Gene name
lpp
Definition
(GenBank) urease-enhancing factor
Organism
heq  Helicobacter pylori F32
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: BAJ58073
UniProt: E6NNZ7
Position
525200..525370
Genome map
AA seq 56 aa AA seqDB search
MKTIRNSVFIGASLLGGCTSVETYFDALRVACVKDAVIEKEARHTPKDFGSPYHTE
NT seq 171 nt NT seq  +upstreamnt  +downstreamnt
atgaaaaccattagaaatagcgtgttcattggagcgtctttactcggcggttgcactagc
gttgaaacttattttgacgctttgcgtgttgcttgcgttaaagacgctgttatagagaaa
gaagcacgccacacacccaaagattttggtagcccttaccacactgaataa

DBGET integrated database retrieval system