KEGG   Helicobacter pylori F32: HPF32_t16Help
Entry
HPF32_t16         tRNA      T01911                                 

Definition
(GenBank) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
heq  Helicobacter pylori F32
Pathway
heq00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:heq00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    HPF32_t16
Non-coding RNAs [BR:heq03100]
 Transfer RNA
  tRNA
   HPF32_t16
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(431262..431348)
Genome map
NT seq 87 nt NT seq  +upstreamnt  +downstreamnt
gcccaggtggtggaattggtagacacaagggacttaaaatccctcggtagcaataccgtg
ccggttcaagtccggctttgggcacca

DBGET integrated database retrieval system