KEGG   Helicobacter pylori F32: HPF32_t17Help
Entry
HPF32_t17         tRNA      T01911                                 

Definition
(GenBank) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
heq  Helicobacter pylori F32
Pathway
heq00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:heq00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    HPF32_t17
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:heq03100]
    HPF32_t17
Non-coding RNAs [BR:heq03100]
 Transfer RNA
  tRNA
   HPF32_t17
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(431744..431818)
Genome map
NT seq 75 nt NT seq  +upstreamnt  +downstreamnt
gcgggaatagctcagtggtagagcacgaccttgccaaggtcggggccgcgggttcgatcc
ccgtttcccgctcca

DBGET integrated database retrieval system