KEGG   Helicobacter pylori F32: HPF32_t18Help
Entry
HPF32_t18         tRNA      T01911                                 

Definition
(GenBank) tRNA-Gln
  KO
K14223  tRNA Gln
Organism
heq  Helicobacter pylori F32
Pathway
heq00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:heq00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    HPF32_t18
Non-coding RNAs [BR:heq03100]
 Transfer RNA
  tRNA
   HPF32_t18
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
484423..484497
Genome map
NT seq 75 nt NT seq  +upstreamnt  +downstreamnt
tggggtgtcgccaagcggtaaggcaccaggttttggtcctggcattccgaggttcgaatc
cttgcaccccagcca

DBGET integrated database retrieval system