KEGG   Haemophilus influenzae PittEE (nontypeable): CGSHiEE_t09428Help
Entry
CGSHiEE_t09428    tRNA      T00543                                 

Definition
(GenBank) tRNA-Met
  KO
K14230  tRNA Met
Organism
hip  Haemophilus influenzae PittEE (nontypeable)
Pathway
hip00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:hip00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    CGSHiEE_t09428
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hip03100]
    CGSHiEE_t09428
Non-coding RNAs [BR:hip03100]
 Transfer RNA
  tRNA
   CGSHiEE_t09428
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(1157638..1157714)
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
ggctacatagctcagttggttagagcacaacactcataatgttggggtcgcaagttcgaa
tctcgctgtagccacca

DBGET integrated database retrieval system