KEGG   Halalkalicoccus jeotgali: HacjB3_07740Help
Entry
HacjB3_07740      CDS       T01271                                 

Definition
(GenBank) glutaredoxin 2
Organism
hje  Halalkalicoccus jeotgali
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: DUF836 Glutaredoxin Thioredoxin_3
Motif
Other DBs
NCBI-ProteinID: ADJ14933
UniProt: D8J2H6
Position
1438929..1439177
Genome map
AA seq 82 aa AA seqDB search
MSEPTVITVYTRENCHLCSEAIRTIEDVASGVDRSVEIESIDVDEAGLAEEYGERVPYVL
VDDRPAFKYRVDPDELRAELLP
NT seq 249 nt NT seq  +upstreamnt  +downstreamnt
gtgagcgagccaaccgtcatcaccgtctacacccgcgagaactgccacctctgctcggag
gcgattcggacgatcgaggacgtggcgagcggggtcgaccggtcggtcgagatcgagtcc
atcgacgtcgacgaggcgggcctcgccgaggagtacggcgagcgcgttccgtacgtgctc
gtcgacgacaggccggcgttcaagtatcgcgtcgatcccgacgagctccgcgccgagcta
ctcccatag

DBGET integrated database retrieval system