KEGG   Halalkalicoccus jeotgali: HacjB3_t15288Help
Entry
HacjB3_t15288     tRNA      T01271                                 

Definition
(GenBank) tRNA-Glu
  KO
K14224  tRNA Glu
Organism
hje  Halalkalicoccus jeotgali
Pathway
hje00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:hje00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    HacjB3_t15288
Non-coding RNAs [BR:hje03100]
 Transfer RNA
  tRNA
   HacjB3_t15288
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
1435704..1435778
Genome map
NT seq 75 nt NT seq  +upstreamnt  +downstreamnt
gctccgttggtgtagtccggccaatcatcttgccctctcacggcaaggaccagggttcga
atccctgacggagca

DBGET integrated database retrieval system