KEGG   Halalkalicoccus jeotgali: HacjB3_t15290Help
Entry
HacjB3_t15290     tRNA      T01271                                 

Definition
(GenBank) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
hje  Halalkalicoccus jeotgali
Pathway
hje00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:hje00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    HacjB3_t15290
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hje03100]
    HacjB3_t15290
Non-coding RNAs [BR:hje03100]
 Transfer RNA
  tRNA
   HacjB3_t15290
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
1450525..1450609
Genome map
NT seq 85 nt NT seq  +upstreamnt  +downstreamnt
gcgcgggttgccgagccaggccaaaggcgcagcgcttaggacgctgtcccgtaggggtcc
gccggttcgaatccggtcccgcgca

DBGET integrated database retrieval system