KEGG   Haloarcula marismortui: pNG5037Help
Entry
pNG5037           CDS       T00211                                 

Definition
(GenBank) unknown
Organism
hma  Haloarcula marismortui
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAV44459
UniProt: Q5V7J0
Position
pNG500:32160..32423
Genome map
AA seq 87 aa AA seqDB search
MSKTVRCTVENRQRVRRAARALQETAPTAVVETMPPVRSEHDAWTLDAVLRETDGVPPEV
LRELALTGLTLQPTPTQAEHQYLVATA
NT seq 264 nt NT seq  +upstreamnt  +downstreamnt
atgagtaagaccgttcgctgtacggtcgagaaccgccagcgcgttcggcgtgccgcccgt
gcgctacaagagactgccccgaccgccgtagtcgagacaatgccgccggtccgctcggaa
cacgacgcctggacgctcgatgccgtgcttcgcgagaccgatggcgttccgccggaagtg
cttcgggaactcgcgctgactgggctgacgctccagccgacgcccacgcaggctgagcat
cagtatctcgtggcgacggcctga

DBGET integrated database retrieval system