KEGG   Haloarcula marismortui: pNG5048Help
Entry
pNG5048           CDS       T00211                                 

Definition
(GenBank) unknown
Organism
hma  Haloarcula marismortui
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAV44468
UniProt: Q5V7K1
Position
pNG500:39342..39548
Genome map
AA seq 68 aa AA seqDB search
MSHDDDDERYDASQQEFDDVSELLLPESSSVDSQLRLHDAEANTLLYVTESSEGISVNVR
DDSAFTDG
NT seq 207 nt NT seq  +upstreamnt  +downstreamnt
atgtcacacgatgatgacgacgaacggtacgacgcttcccagcaagagttcgacgacgtg
tctgaacttcttctgccggaatcaagtagtgtcgacagtcagctccgactccatgatgcg
gaggcaaacacgcttctctacgttacggagagtagtgagggcatctcagtgaacgtccgc
gacgactcggcgtttactgacggatga

DBGET integrated database retrieval system