KEGG   Haloarcula marismortui: pNG5053Help
Entry
pNG5053           CDS       T00211                                 

Definition
(GenBank) unknown
Organism
hma  Haloarcula marismortui
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAV44473
UniProt: Q5V7K4
Position
pNG500:43386..44960
Genome map
AA seq 524 aa AA seqDB search
MNWISQIPSILFTFLIVTSLAVGGATGHVQSGAQGTVADSEIFEEVGDIVKIPVRVSPHD
TATVNISRKQYSAEVTATDQDGDGQIQIRINTFETQTSGNPSGYSVSSPDHLREVSQRGD
NGLTEGEYDIAVDGNAPDSTLSLSSGVFQPGQLHTLPASEKITKTNVIRNGSPTPSQIAR
GDILIAEFEAEGIMGVGRFDDPPGNNGIVAVDSTVGTKTAHTVQVQGEGANTSFREMRIS
YDNAANELPSDLVKLNITHAGVDSDQDGQIDRSFISSIVNVNTNSEGIIKITTTDQQTVS
GSETVLLRYENVTNPSRPGAYPATISLGPNRIDTTVEYGPAATGNLGNGLNVKASTTSSN
RFVAPLPFKYFTSPDDDRLYVAMDTSGLNNVTRESISLRLSQSRKEGPIAAKKSATNATL
VEPTANMAIANDQWQAGSEPLEITGTTTLAPNTDIWIRVRSGTDVPSPWIYHYPTSIQSN
RTFEADITEDRIEANEPVYVSTVTRTGPVGPEEIVNVTNRTEQN
NT seq 1575 nt NT seq  +upstreamnt  +downstreamnt
atgaactggataagccagattccatcaatcctatttactttcttgatcgtcacttcgcta
gcagttggcggtgctaccggacacgtccagtctggggcacagggtacggtggctgactct
gaaatatttgaagaagtaggcgatattgtaaagataccagttcgtgtctcaccgcatgac
acggcaacagtcaacatttctcggaagcagtactcagcagaggttactgcaactgatcag
gatggtgacggccagatccagatccgaatcaatacatttgaaacacagacttcaggcaat
ccgtctgggtatagtgtctcgtctccagatcacttgcgcgaagtttctcagcggggcgat
aatgggctcaccgagggagagtatgatatagctgtcgacggaaacgcacccgactcaaca
ttatcactcagttcaggtgtgttccaacctggccaactgcatacattgcctgctagtgag
aaaataaccaaaaccaatgttatcaggaacgggtcacctactccaagccagattgctcgt
ggtgacatattaatcgcagagttcgaagcggaaggaatcatgggcgtcggtcgatttgac
gatccgccaggaaacaacggaatcgtcgcagtagacagtactgtggggacgaagacagct
catacagttcaggtgcaaggagagggggctaatacatcatttcgggagatgcgcattagc
tacgataacgcggcaaacgagttaccatcagatcttgtcaaattaaatataacccacgct
ggtgtagattcagatcaagatgggcaaattgatcgatcattcatttcatcaatcgtaaat
gtaaatacgaactctgagggaataataaaaatcacaactaccgaccaacaaactgtgtca
gggtcagaaactgtactcctacgatatgaaaacgttacaaatccatccagacctggtgct
taccctgcaactatctcgctcggaccaaaccgaatcgacacaacagtagagtatggtcca
gccgcaacaggtaatcttggaaacggattaaatgttaaagctagcacaactagttcaaat
agatttgtcgcaccgctgccgttcaagtatttcacctcaccagatgatgaccggttgtat
gtcgcaatggataccagtgggctgaacaatgtaactagagagtcaatatcactgaggctt
tcccaatctcgaaaagaagggcccatagcggcaaaaaagtcagcaacgaatgccaccctt
gttgaaccgactgctaatatggcgatagcaaatgaccagtggcaggctggatcagagcca
ctggaaattacaggtaccacgaccttggctcctaataccgacatttggatccgggttcgc
tcaggtactgatgttccatcgccttggatatatcattatcccacatctattcaatcaaac
agaacttttgaggcagacatcacagaagacaggattgaggccaatgagcccgtttacgtt
agtacggtaacaagaactggcccagtcggtccggaggagatagttaacgtgacaaacagg
actgagcaaaattag

DBGET integrated database retrieval system