KEGG   Haloarcula marismortui: pNG5054Help
Entry
pNG5054           CDS       T00211                                 

Gene name
tnp
Definition
(GenBank) probable ISH11 transposase
Organism
hma  Haloarcula marismortui
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAV44474
UniProt: Q5V7L0
Position
pNG500:45023..45325
Genome map
AA seq 100 aa AA seqDB search
MDSATLQNEPPVESFFNVAETETLALFEYLSFEFPGEFDVFAPAKTGRTREHKPPEMLRG
FLHCYYRDICGIRPAERELQNTVVWLSCVFDRPPSRDAVD
NT seq 303 nt NT seq  +upstreamnt  +downstreamnt
atggactcagcgaccctgcagaatgagcctccggtagagtcgttcttcaatgtcgcagag
accgagacgttagcgttgtttgagtatctctccttcgagtttcctggcgagttcgacgtg
ttcgccccggcgaagacggggcgaacacgagagcataaaccaccagagatgctgcgtggg
ttcctgcactgctattaccgtgatatctgcggaattcgtcctgctgagcgggagcttcag
aacacggttgtctggctaagctgtgtcttcgatcgaccgccgtcaagagacgcggtcgat
tga

DBGET integrated database retrieval system