KEGG   Haloarcula marismortui: pNG5059Help
Entry
pNG5059           CDS       T00211                                 

Definition
(GenBank) unknown
Organism
hma  Haloarcula marismortui
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAV44479
UniProt: Q5V7L1
Position
pNG500:complement(47496..47747)
Genome map
AA seq 83 aa AA seqDB search
MAVNQTELAVKHLRTVGEHDFRDGPSLSAADCRRRDSVTTDDRCPARWTVTGRTGRQVVD
SLEQTCGHQVLSKLREASFRKTP
NT seq 252 nt NT seq  +upstreamnt  +downstreamnt
atggcggtgaaccaaaccgaactagctgtgaagcatcttcgaaccgttggtgagcatgat
tttcgggatggaccgtcgctgtcggcggcggactgccgccgacgcgacagtgtcaccact
gacgaccgctgtccggcccgatggacagttaccggaagaaccggtcgtcaagtggttgat
tcgctggaacagacctgcggacaccaagtgctgtccaaactgcgcgaagcgtcatttcgc
aaaactccgtga

DBGET integrated database retrieval system