KEGG   Haloarcula marismortui: pNG5061Help
Entry
pNG5061           CDS       T00211                                 

Definition
(GenBank) putative collagenase
Organism
hma  Haloarcula marismortui
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAV44480
UniProt: Q5V7L6
Position
pNG500:48189..48926
Genome map
AA seq 245 aa AA seqDB search
MIGVVIVAVVGAGTATSTGIPALQVPNPTSEPTPTPTTNLETTPDPTPESTPTATPTPES
TPTATPTPESTPTATPTPESTPTATPTPESTPTATPTPESTPTPAANTVVVEIGDWGEAV
HNGSEVRFRVTKYRITELIEESDGDVETPSEGDKFVVATIQMATDPGNNVTVGQEQWSFT
GLADKEHSSHEVTFGIRNGFPNKTELHGDNVQGTIVWEVKYPNDAEFNMVPYNNQTGQAG
RVVTD
NT seq 738 nt NT seq  +upstreamnt  +downstreamnt
atgattggtgttgtcatagttgctgtagtaggtgctggtactgcaaccagcactggaatc
ccagcattgcaagtgccgaatccgacttcagagccaaccccaacaccaacaacaaactta
gaaacaactccggacccaaccccagaatcaactccgacagcaaccccaaccccagaatca
actccgacagcaaccccaaccccagaatcaactccgacagcaaccccaaccccagaatca
actccgacagcaaccccaaccccagaatcaactccgacagcaaccccaaccccagaatca
actccgacaccagcagcaaacacagtggttgtcgaaattggggactggggtgaggcagta
cataatggttcagaggtccggtttcgagtaactaagtataggatcaccgaacttattgaa
gagagtgatggagacgtagaaacgccatcggaaggtgataaatttgtagttgccactatt
cagatggcgacggatcccggaaataacgttactgtcggacaagagcaatggtcatttact
ggacttgccgataaggagcatagctcacatgaggtgactttcggcatccggaatgggttc
cctaataaaacagagttgcatggagataatgtccaaggtactatagtttgggaagtaaaa
tacccaaacgatgcagagttcaacatggtaccttataacaaccaaactgggcaggcaggc
cgtgtcgtcacggactaa

DBGET integrated database retrieval system