KEGG   Haloarcula marismortui: pNG5073Help
Entry
pNG5073           CDS       T00211                                 

Definition
(GenBank) unknown
Organism
hma  Haloarcula marismortui
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAV44492
UniProt: Q5V7M6
Position
pNG500:complement(64895..65188)
Genome map
AA seq 97 aa AA seqDB search
MFRQRIVDVVVIAGRFDCGFSTSVSLGEVVEVRVLDANLFDDLTSLIHYCHLCVPFVEAL
VNHWTASASTVRIRKMKRETVADSYLRSPASQATSFS
NT seq 294 nt NT seq  +upstreamnt  +downstreamnt
atgttccgacagcgtatcgtggatgtggtagtaattgctggtcgcttcgattgcggcttc
agcaccagcgtatcgctgggcgaggtcgtcgaggttcgcgttctcgacgcgaacctcttc
gacgatctcaccagcctcatccactactgccacctgtgcgtaccgtttgtggaggctctg
gtgaatcactggacggcgtcggcttcgaccgtcagaattaggaagatgaagcgggaaacc
gtcgctgattcatatctaagatctcccgcttcacaagcaacgtcgttcagttag

DBGET integrated database retrieval system