KEGG   Haloarcula marismortui: pNG5081Help
Entry
pNG5081           CDS       T00211                                 

Definition
(GenBank) unknown
Organism
hma  Haloarcula marismortui
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAV44498
UniProt: Q5V7N4
Position
pNG500:complement(70085..70597)
Genome map
AA seq 170 aa AA seqDB search
MPIVKWGETIQNKLSEGWSREIERDLAGEVEFPVFIDCVYQQGRYDEHGVARHGYAADAP
FIDTPRDAREHYSKRFGIESSYRLAKQSLAFTSSQDAGLRLVMFVVSLLLQNNWRYLHWR
YAAAPRRGGRRLLQWSFTEFYEMTLRAAWTALGVRRSVPANQPLDDRFFR
NT seq 513 nt NT seq  +upstreamnt  +downstreamnt
atgccgatcgtcaagtggggtgagacgattcaaaacaaactcagcgaaggctggagccgc
gagatcgaacgcgatctcgctggcgaggtggagttccctgtgttcatcgactgcgtgtac
cagcagggacggtacgacgaacatggggtggcgcgtcacggctacgccgctgacgcgccc
tttatcgacacgccacgagatgcacgagagcactacagcaagcgcttcggcatcgaatca
agctaccgattagccaagcagagcctcgctttcactagttctcaggatgctggactgcgg
ttggtaatgtttgtagtgagcctactgcttcagaacaactggcgatatctccactggagg
tacgcggcggcgccccgccgcggggggcgccgcctcttgcagtggtcgttcacggagttt
tacgaaatgacgcttcgcgcggcttggacagcactcggtgtccgcaggtctgttccagcg
aatcaaccacttgacgaccggttcttccggtaa

DBGET integrated database retrieval system