KEGG   Haloarcula marismortui: pNG5082Help
Entry
pNG5082           CDS       T00211                                 

Definition
(GenBank) unknown
Organism
hma  Haloarcula marismortui
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAV44499
UniProt: Q5V7N3
Position
pNG500:71627..71836
Genome map
AA seq 69 aa AA seqDB search
MWDHLLELDMIGTIDGKKRTGDGQGGEKYYWEMSTGTGTTIEVLESISRLDDVIDIVVSS
AQHSNITNY
NT seq 210 nt NT seq  +upstreamnt  +downstreamnt
atgtgggaccaccttcttgagttggatatgatcggaacaatcgacgggaagaaacgcacg
ggcgacggtcaaggtggcgagaagtactactgggagatgagtacgggtacagggacgact
atcgaggtcctcgaatcaattagtcgccttgacgatgtcattgacattgtcgtttcgtca
gcgcagcactcgaatatcacgaactactga

DBGET integrated database retrieval system