KEGG   Haloarcula marismortui: pNG5092Help
Entry
pNG5092           CDS       T00211                                 

Definition
(GenBank) unknown
Organism
hma  Haloarcula marismortui
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAV44509
UniProt: Q5V7P4
Position
pNG500:85636..86001
Genome map
AA seq 121 aa AA seqDB search
MSQPHLSPEPQPSNQRQIPSMETIGPVVDEVIDIARQELDAPRSVKIKTWEDREFLVRVK
HGSAPGVNTRYGYETAIQYHSDRETVEAFLIEEDTHTDEAERLLKMELGTIPDPVPEKIG
E
NT seq 366 nt NT seq  +upstreamnt  +downstreamnt
atgtcacagccacacctttctccagagccacagccatccaaccagcgtcagattccgagc
atggaaacgatcgggccggtcgtcgacgaagtgatcgacattgcccggcaagaactcgat
gcaccgcggtcagtgaaaatcaaaacatgggaggatcgcgagtttctggtgcgtgtcaag
cacggctcagcaccaggcgtaaacacccggtatggatacgagacagcaatccagtatcac
agtgatcgggaaaccgtcgaagccttcctgatcgaagaggatacccacactgatgaagca
gaacgcctcctgaagatggaactcggaacgatacccgatccagtaccagaaaaaattggg
gagtag

DBGET integrated database retrieval system