KEGG   Haloarcula marismortui: pNG5099Help
Entry
pNG5099           CDS       T00211                                 

Definition
(GenBank) unknown
Organism
hma  Haloarcula marismortui
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAV44514
UniProt: Q5V7R8
Position
pNG500:complement(89645..90133)
Genome map
AA seq 162 aa AA seqDB search
MHMLIYALVEASTADAALAAGKGVFDNLVGVDRHSDAVFDYYVTFDESSTVAGKSRWGER
PTAAPVDSEAGQELLGDGWETTKSAFERNLQTVKDALDELSDEEIMRDKDLARCAFQRVG
AAKGPEIALYEEHGCGIRDRTQLDRLLDESDNLWIVPADVHF
NT seq 489 nt NT seq  +upstreamnt  +downstreamnt
atgcatatgctcatctacgcgctcgttgaggcatcgacagcagacgcagcactcgccgct
ggcaagggcgtcttcgacaacctggtcggcgtcgacaggcactcagacgcagtgttcgac
tactacgtcacgttcgacgagagttccaccgtcgcaggcaaatcccggtggggcgagcgt
ccgaccgcggccccggtcgactccgaggccggccaagaactccttggggatggctgggag
acaacgaagtcagcgttcgagcgtaatctccagacggtcaaagacgccctcgacgagctt
tcagacgaggagattatgcgcgacaaagacctcgctcgatgtgcgttccagagagtcgga
gccgccaagggtccagagattgcactgtacgaggaacacggatgcgggattcgcgatcgg
acgcagcttgaccggcttctggacgagagtgacaacctctggatcgtccccgccgacgtc
cacttctga

DBGET integrated database retrieval system