KEGG   Haloarcula marismortui: pNG5102Help
Entry
pNG5102           CDS       T00211                                 

Definition
(GenBank) unknown
Organism
hma  Haloarcula marismortui
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAV44516
UniProt: Q5V7P7
Position
pNG500:90868..91044
Genome map
AA seq 58 aa AA seqDB search
MTTGTDAGVTPDSHAGPVLSVDRRDALGVEDRRVALVGSAGHILGRVTGHHASPAIAW
NT seq 177 nt NT seq  +upstreamnt  +downstreamnt
atgaccactggaacagacgctggcgtgacgcccgacagccatgcagggcccgtactctcc
gtcgacagacgcgatgcgcttggcgtcgaagatcggcgcgtcgcactcgtcggttctgca
ggtcatatactgggacgagtcactggacatcacgcatcgcccgccatcgcttggtga

DBGET integrated database retrieval system