KEGG   Haloarcula marismortui: pNG5109Help
Entry
pNG5109           CDS       T00211                                 

Definition
(GenBank) unknown
Organism
hma  Haloarcula marismortui
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAV44523
UniProt: Q5V7R3
Position
pNG500:95902..96882
Genome map
AA seq 326 aa AA seqDB search
MAEDEDQHTGFVPWSKRNTSFEEKVKEDLAGTAQDRLANVVSEYSKKWVIIETARKHEGE
FGVTKGDFDRSQSVNDLRRLQTGLLKHVDRDKALTYIEFLLNTSWSECDGHKDRVADLMK
MDDKIRRVLREERIMMELKPERDQLPLVETEDHLGRETETLYDPDEFGSFQFEKLADQSF
VEADQRLRGLTKGERWEDELAGYNEAWELYEDGTFTFHIAEKLYNSLEAVTQKICVELED
WGDEGDSFGDYIEQMRGNGLFEPNGAMQHEWQQILKGVQTGVGRTGGDRKRHGRIDQDYA
ILLLHQVASFLGFIIKRYESEYGISS
NT seq 981 nt NT seq  +upstreamnt  +downstreamnt
atggctgaggatgaggaccagcataccggcttcgttccttggagcaaacgcaacacctcc
tttgaggaaaaagtcaaggaagacttggctgggacggcacaggaccgcctcgccaacgtg
gtctccgagtactccaagaaatgggtgatcatcgaaaccgcccggaagcacgaaggcgaa
ttcggggtgacgaaaggtgacttcgaccggagccagtcggtgaacgacttgcggagactg
cagactgggttgctgaagcacgtggacagggacaaggcattgacctacatcgagttcctg
ttgaatacgtcttggtcggagtgtgatgggcacaaggaccgggtggctgacttgatgaag
atggatgataagatccgtcgggtactacgggaagagcggattatgatggagttgaagccg
gagcgagaccagcttccgttggtcgaaaccgaggaccatctcggtagggagaccgagacg
ctatacgaccccgatgagttcggttcgttccagttcgagaagttggcggaccagtcgttt
gtcgaggcggatcagcggcttcgcggcttgaccaagggtgagaggtgggaggacgagtta
gcagggtacaatgaggcgtgggaattgtacgaggacgggacgtttaccttccatatcgct
gagaaattgtacaatagcttggaggcggtgactcagaaaatctgcgtcgaacttgaggat
tggggagatgagggcgatagcttcggggattatattgagcagatgcggggaaacggcttg
tttgagccaaacggtgcgatgcagcatgagtggcagcagattctaaagggagtgcagacc
ggtgtgggtcggaccggcggtgatcggaaacggcatggacggattgaccaggactacgcg
atcctgctgcttcaccaggtggcgtccttcctcggattcatcatcaagagatacgaatca
gaatacggcatttcctcctga

DBGET integrated database retrieval system