KEGG   Haloarcula marismortui: pNG5120Help
Entry
pNG5120           CDS       T00211                                 

Definition
(GenBank) unknown
Organism
hma  Haloarcula marismortui
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAV44533
UniProt: Q5V7E4
Position
pNG500:complement(104240..104608)
Genome map
AA seq 122 aa AA seqDB search
MSEDLKERFSDHQDQSSDKDAEDTEIAEEETGQAEAEAANSRPKAEIPVRDRNQVTMYLG
DDREDDISKLFQEANAQSVLADDGEISKNDEFYPALVDFVTDHKRTEFLKFLGLEADADE
TE
NT seq 369 nt NT seq  +upstreamnt  +downstreamnt
atgagtgaagacctgaaagagcggttcagcgatcatcaagatcaaagtagcgacaaggac
gctgaagatactgaaatcgcagaagaagaaaccggacaggctgaggcagaagcagcaaac
tctcgacccaaagcagagatcccagtcagagatcggaatcaggttacgatgtatctcggt
gacgaccgagaagatgacatctccaagctgtttcaagaggccaacgcacagtctgtcctt
gctgatgatggagaaatatcgaaaaatgacgagttctaccctgcactggttgatttcgtg
actgatcacaaacggacagaattcttgaaatttttgggtttagaggcagatgccgacgaa
accgagtga

DBGET integrated database retrieval system