KEGG   Haloarcula marismortui: pNG5136Help
Entry
pNG5136           CDS       T00211                                 

Definition
(GenBank) unknown
Organism
hma  Haloarcula marismortui
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAV44548
UniProt: Q5V7Q3
Position
pNG500:119097..119264
Genome map
AA seq 55 aa AA seqDB search
MDSATLQNDPSVESFFNVVETETLALFEHLSFEFLEEFDVFAPTIVPSGSYEGRV
NT seq 168 nt NT seq  +upstreamnt  +downstreamnt
atggactcagcgaccctgcaaaatgatccttcggtcgagtcgttcttcaatgtcgtggag
acagagacgcttgcgttgttcgagcacctctccttcgagtttctcgaagagttcgacgtg
ttcgccccgacgatagtgcctagtggaagttatgaaggtagagtttga

DBGET integrated database retrieval system