KEGG   Haloarcula marismortui: pNG5141Help
Entry
pNG5141           CDS       T00211                                 

Definition
(GenBank) unknown
Organism
hma  Haloarcula marismortui
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAV44553
UniProt: Q5V7G1
Position
pNG500:126606..127481
Genome map
AA seq 291 aa AA seqDB search
MVVISETRPCDLPPIRCWGGATMTFVPGIQAKKNTTQFLPDCRETEARWHWAPAVPPECR
RHKRVLCPAHGSARVTPRCGPACGGNQNSFLSYELPSNNSISALRHSDTLLAPRLFGQSG
SNAALDRDRHADSHQRVRRLSCLQQQNGGHLGGVRSGVEATIRDRQRAPTLPQPEGWTHP
TRVDRGQSPPAADTGGDKNGCDIPAVSVGLLQYCSRDNHTDQHRLTATGFSNCAPQNGGQ
PEDPGVPRTTQYCRSRRQVLHPTHSLRQPAIGETWSAGQNLSSDSSAVIGL
NT seq 876 nt NT seq  +upstreamnt  +downstreamnt
atggtggtaatatcggagacacggccgtgtgatctacccccgatccgttgctggggaggg
gcgacaatgacgttcgttccgggcatacaagccaagaaaaataccacgcagtttttaccc
gactgccgggaaacggaggccaggtggcactgggcacctgctgtgccacccgaatgtcgg
aggcacaagcgggttctttgccccgcacacggctcggccagagtgacgccgcgatgtggc
ccagcctgtggcggcaatcagaactcgtttctctcgtatgaactacccagtaataattct
atttcagccctgcgacacagcgacacacttctggccccccgactcttcggacagtcaggt
tccaacgcggcgctggaccgtgaccgtcacgcagatagccaccagcgggtgcgacgactt
tcctgtctacagcaacagaatggtgggcatcttgggggtgtgagaagtggggtggaagcc
accatccgagatcggcaacgagctccgaccctgccacaacctgagggatggacacatcca
acgcgagttgacagaggccagagcccacctgccgctgacacgggtggtgataaaaacggc
tgcgatatccccgcggtgtctgtcggtttgctacaatattgttctcgagacaatcacacc
gaccagcatcgcctgacggcgacagggttctcaaactgtgcaccgcagaatggtgggcag
ccggaagaccccggcgtgcctcgcaccacccaatattgccgttcccggcgacaggtcctg
cacccaacacattcgcttcgtcaaccggctatcggggaaacatggagcgcggggcagaac
ctatcctctgatagcagtgctgtcattggtctttag

DBGET integrated database retrieval system