KEGG   Haloarcula marismortui: pNG5143Help
Entry
pNG5143           CDS       T00211                                 

Gene name
tnp
Definition
(GenBank) putative ISH8 transposase
Organism
hma  Haloarcula marismortui
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAV44555
UniProt: Q5V7F7
Position
pNG500:complement(129944..130312)
Genome map
AA seq 122 aa AA seqDB search
MRRLTTLFPSEFLEEHAEELGVVERDRNPQIPVLVWALVFGFAAGESRTLAGFRRSYNST
ADETISPGGFYQRLTPMLAKYLRDLVEHGLDEVAVPDTVDADIGRFCCVDLMETLLSQES
VN
NT seq 369 nt NT seq  +upstreamnt  +downstreamnt
atgcgtcggctcactacactgtttccttctgagttcctcgaagagcacgccgaggaactc
ggcgtggtcgagcgtgaccgtaacccccagatacctgtcctcgtatgggcgctcgtgttc
ggcttcgccgccggcgagagccgaacactcgctgggttcagacgcagctacaactctaca
gccgacgagacgatctctcccggtggattctatcagcggttgacgccgatgctggcgaag
tacctccgcgacctcgtcgagcacggcctcgacgaggtcgctgttcccgatactgttgac
gctgatatcggccgattctgctgtgttgacttgatggaaacactgctatcccaagagagc
gtgaactaa

DBGET integrated database retrieval system