KEGG   Glaesserella parasuis ZJ0906: K756_t12266Help
Entry
K756_t12266       tRNA      T02697                                 

Definition
(GenBank) tRNA-Lys
  KO
K14229  tRNA Lys
Organism
hpaz  Glaesserella parasuis ZJ0906
Pathway
hpaz00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:hpaz00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    K756_t12266
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hpaz03100]
    K756_t12266
Non-coding RNAs [BR:hpaz03100]
 Transfer RNA
  tRNA
   K756_t12266
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 16166772
Position
complement(2246148..2246223)
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
gggtcgttagctcagtcggtagagcagcggacttttaatccgttggtcgaaggttcgaat
ccttcacgacccacca

DBGET integrated database retrieval system