KEGG   Helicobacter pylori Sat464: HPSAT_t07826Help
Entry
HPSAT_t07826      tRNA      T01897                                 

Definition
(GenBank) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
hpt  Helicobacter pylori Sat464
Pathway
hpt00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:hpt00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    HPSAT_t07826
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hpt03100]
    HPSAT_t07826
Non-coding RNAs [BR:hpt03100]
 Transfer RNA
  tRNA
   HPSAT_t07826
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(513824..513900)
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
gtccttgtagctcagctggatagagcgtatgattcctaatcgtaaggtcgtgggttcgaa
tcccgccaaggacacca

DBGET integrated database retrieval system