KEGG   Homo sapiens (human): 100132101Help
Entry
100132101         misc_RNA  T01001                                 

Gene name
HERC2P7
Definition
(RefSeq) hect domain and RLD 2 pseudogene 7
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 100132101
HGNC: 4875
Position
15q11.2
NT seq 1779 nt NT seq  +upstreamnt  +downstreamnt
aggtctgggcagcgtcttcctgaacagcctgaagcagaaggtggtgaccctggcaagcag
cgcagacgtgctgagcaccgtgcagtcggcctcccaggccatgctgcagagcggctggtc
catgctgttgcccaccgctgagaagcaggcccgggcactctgctctcctgtcctgcggag
tttcaggcaatgaagtgagcataagtccaggtcatcgattggtgattgatcttctggtgg
gcagcttgatggctgatggagggttggagtcagccttacacgcagccattactgcagaga
tccaggatacaaaaaaagaagcacggaaggaaaaagaaatttatgaacaggaagcaaatg
cctcaacatttcatagaaggaggactccattggataaagaccttattaatacggggatct
gtgagtcttctggcaaacagtgtttgcctctggttcagctcatacaacagcttcttaggt
aaatcatattagctgtattgtattgtgttttatttatttacttttttgttttttgagaca
gagtttcgctcttgttgcccaggcccgagtgcagtggtgcgatcttgactcactgcaacc
tccgcctcccaggttcaagtaattcctctgcctcagcctctcgagcagctgggattacag
gcatgcgccaccatgccccactaattttgtaattttattagagacagggtttcttcatgt
tggtcaggccggtcttgaactcccaacctcaggtggtccatccactttggcctatcaaaa
tgttgggattacaggcattagccaccacgcctggcctatttatttacttattaatggtgt
tttttttttttttttttttttgagatggagtcttgctctatcgtccaggctggagtgcag
tgtcacgatcttggctcactgcaacccccgcctcctgggttcaagctattctcctgcctc
agcctcccgagtagctgggactacaggcgtctgcaaccacacctggctgatttttgtatt
tttagtagagatggggttttaccatattggtcaggctggtctcaaattcctgacgtcagg
tgacccacctgccttggcctctcaaaatgttgggattacaggtgttagccactgtgcctg
gcctgtattgtattttaataggtgattattggttttcatattaagatagtgaaatctagc
gcaaggatctcaaaaatttgtttgatgattgaaggaatattctgaaaattacctagtata
gatgttaggataaagagcagacccttttcaatataggtgagaggagaagttggagggtgt
gatgatactcaaaagtttttcactgaagagaaattggggcgtgcagtaaacatgtaaaaa
gattcttactaataagcaggtggatgcaaatgaaaatcatcatggaaggttatttttaaa
actgattgtatcattgcctcactttatatattacagagttatacatactactttgtaaga
taacttttcttttcaaaactgaagtcaatgtgatagaatggtgagcattattttggaagg
ccagactaggaggaggtgggaggaagaagtcagactcagcctgtgaacagacgctaacct
tggcagaagccaaaacagtcagacagtgttgtgtaaaaatgatcattcaagaagagcgaa
acagcaaggtgatttgtgaaagagatttattagaaaatgaaacacatttatacctctgtt
caataaaaatctgcttttcgtcaaaaaaaaaaaaaaaaa

DBGET integrated database retrieval system