KEGG   Homo sapiens (human): 100287559Help
Entry
100287559         lncRNA    T01001                                 

Gene name
ADPGK-AS1
Definition
(RefSeq) ADPGK antisense RNA 1
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 100287559
HGNC: 44144
Ensembl: ENSG00000260898
Position
15q24.1
NT seq 2730 nt NT seq  +upstreamnt  +downstreamnt
aaaagtacaaagaaaggaggtagtgtcatttggaagaaccttaaatatgcagtgtcactg
aagtcaggggaagaaaagaatttcacggagaagggcgtgttcaatgcgtggaaggctgca
gagtagataatgaagattcaaaaaggcaaatctgagaggagttgcagtacagtcgtgtgg
tttctagactacacggcgtttcgaaagtgggtaaaggcagacatcacgcgtcttcaagaa
gttcagaagaaagaggaagagtgttgtcatagtgggtaaggtcaagtatctttgattgca
aaacaacagtcgccagaagagaaggggctaaaagttggaacgaggaagaaggctcggaga
aaggtgtcagacaaagcgggattagcaagaagctgttagggctggtcctaccgggatgag
agaaaggcgcagaggccagccgagtggaaagagcagcggtgacgaaccgggttccactca
gacgtccgacacttctcgccaaggggccagcgcggacagcagcgcctcccggggacctct
gagaagccctgtttctgcgcggctccgcccgacctccaaggccgacctcggaggctcaga
gacccaggccccgttggcactcaccccactgccacgcggcgccagcgccggactggccgc
acgataagcgcgtcccaggctgccgccaaccggccctcgggggagacgggtcccgggggc
gcaggcgcgggccccagacacagcgagctccagagagagcgcagcgccgagcctggcagc
tctggctccagcaggaagacgcagcccacggccagcgccaggaagcccgcgtacgcggag
ccgcgccacagcgccatggggacccaggcgccgcacctgcgcgaaccaactcctttccta
gcccgcgcctcttccgggctcggcgcgcgccgatgtcgacacaagcgctacgtcacaagg
gtgcgccacggggccccccaaggggcggggcgacgggcggcgccaggacggagcgagggg
ggaccccacgcctcagtcccaggcctggcactgcggtgttgccgccccggaggaggtggg
acaacggcggttgtgccagtccgggcgctgcacccccttcccggaactctaatcgtatcc
ccaaatagagggatgggaacacatttgctttcgcagtaaaacgaaacggacagattgtga
agaagcggacaaacctcgcgttaatattcgaaccagtgggtgtccccattggcacggatc
acacccccatcttttaatccctccctccgcccgtgtcccctcatttgctagacttgtcct
cttccaggcctagtgctcggcgcttctgagaggaataggctcacagaatagcggcgctgc
cgagacccctggggtacgcgaggcagggggattccgcccctttggaaggtggccgagacc
ctcagccactaaaggacttcgtcgagacaggagagcccgcagagatcgttctcttctgga
taaccagattattccacaatcaaactttaacccttttgggggcgctgttccctttaacaa
actctggaaaatgtacacaatcttgtgcacaacacgagagttatggacctgggttgagaa
acgctgctttcttttgttcccccttggtgacatcacttaaacccagccctctcttcgctg
atacttttctgtgcatgaggctaggttgagagacagtgaagctaggctgggtaccagctc
attctcatcagccacaatgcccggcctagtcttgttccctggtttgtttccacttttcca
attctctcggctcctgaccttggctttgtgtccagttttccactgtgaccctgacctttg
gacttggcagcgaaactttatttccctaactttgatcttgggcattagtcttcattctcc
tcagccccacctcatcagaacttccccatcctggtcatctaccttcccgcagttcatcct
acccagcctacctgaccatgccatccctttcgacaaagatattcacacaggaacagattt
gggctaccttggaaaagaagccaaagagccagtcagatctttatgaagccatgaaagcca
tcttccctagagttgcctgtcacttctctctccttagggagacatgtcagtcagttccta
gagaaactgcttcttctcacaaccctcagctgtcaggtttccctggcacccagaggggac
tgagccagcagctgacctgaaaacagcgagtctgctgactgtccagcgatcatttccctc
tattgagaattttaaccaagtttctgttgtctgtagttatttgatattggctgtggaccc
acaaagtcacacaaggctaaagggtggacagcacggaagaggcagtacatcttaacaaaa
tcagggttctggatgaagggaggggtggtgaatggttgctgcaatcaacagttcatactt
caatggaaagaaggtgggatttgattcctggctgcaaatcttcactctgtcacctgctat
ctgtgtgccctcagggtctcactttgtctcccaggctggagtgcagtggcgcaatcacca
ctcactgcagcctcacctaccgggctcaagtgatcatcccacctcagcctctccagtagc
tgcgaccacaggcacgtgccactaaatgattattttttcaagggagaaatcatgcctgtc
atacaaataaaaaatgaacaagtgtaaaag

DBGET integrated database retrieval system