KEGG   Homo sapiens (human): 284593Help
Entry
284593            lncRNA    T01001                                 

Gene name
FAM41C
Definition
(RefSeq) family with sequence similarity 41 member C
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 284593
HGNC: 27635
Ensembl: ENSG00000230368
Position
1p36.33
NT seq 1779 nt NT seq  +upstreamnt  +downstreamnt
ggaaaagaggcctggaaaagcaccactcctgtccatgaagcccccagatggaaccaggtc
ctgttcagaaaccccatctgtgcctttggagagactgccccgagcacacaggcccagcaa
ccgccatctatggcccccaggacctaatcccttctacatagggttcagtgcatgtgagta
tacaccgggcttgattcctgcctagtccctgccagataccccatgcccacctggtgaaga
gaatgaggccacacaaacacacccaggccatcgtggtgatggagtgcctggggtcctact
tgcccacccttccttgctggttcagagccagctgtctgaccacattcctaccctgagatg
agactttggggacattgtccaccagggtcactgaccccttttaaaattccagaaacagag
ggccagctggtcccctagaagtttggcacatgggataagccaaggcttgccttcaggaac
aggttttccaccacgtcgctgcccaaggcccagggcatccccaagttcatgtggcacctg
cctgccatgtccacaacccatgccgacccctcctagagccactggaatgcttgttcctgg
gcatgtgataaacccagacagcttcagccttgcaggacaactatgcacatctggcagcag
tagccggagggcccatggaaagaagttggaggtgaaaccagatgctgtgaaaatattagg
caaaactgcatactataaaagtgctttaaaatgcagcaggaggagaggtgaagacacaaa
tgaataagtgcttagagacacatggctgtcagaacagttaagaatccacgctgcttcccc
cctttacctagaaaaggaaaattctaggccacctcctcctcagcatactcctcaaactcc
tcctcctcagccgtggcatcctgatattgctgatattcagacaccaggtcgttcatgttg
ctctcggcctcggtgaattccatctcttccatgccctcgcccgtgtaccaatggaggaag
gccttgcgcctgaacattgctgtaaactgctctgagacacgcttgaagagttcctggatg
gccgtattattcccaatgaaggaacagcaagaggaccttgtgcatgaataatttgtttcc
atactacagagtgggtaataagcagattagtaaaaacaattctgcttcacttcaataaca
gcctcctccaactcattttttctcaacaaacttatttttccagcagaagaatcccagact
tcttagagaacccagtgactttttgcaccttaaatctgtgaaatcctcatgttttcttct
gccgtatccatagttcaaacaaagatgaggcaaagctagacgcattcctgaaggaaccca
agaaattcctctctttctctctctggaatgaaatgaattctctagaccaccagttctaac
cttcaaaaaccaaacctgtttgtgagctgtccttcaaatactactgtagaccccagtgtt
tattcattaaattttttaaatatttgttttatttggaatcaaagtatttgtaattttagt
atttgtattaatatcagggagaaatgtttaaatctgtctatgccatatgtgcctctggct
tattgcccaattaattgtagcctcaggctaaactttggtttctgtctttaatttttgtca
gaagaaatataactgatctcaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

DBGET integrated database retrieval system