KEGG   Homo sapiens (human): 439921Help
Entry
439921            CDS       T01001                                 

Gene name
MXRA7
Definition
(RefSeq) matrix remodeling associated 7
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 439921
NCBI-ProteinID: NP_001008528
HGNC: 7541
Ensembl: ENSG00000182534
Vega: OTTHUMG00000180370
Pharos: P84157(Tdark)
UniProt: P84157
Position
17q25.1
AA seq 204 aa AA seqDB search
MEAPAELLAALPALATALALLLAWLLVRRGAAASPEPARAPPEPAPPAEATGAPAPSRPC
APEPAASPAGPEEPGEPAGLGELGEPAGPGEPEGPGDPAAAPAEAEEQAVEARQEEEQDL
DGEKGPSSEGPEEEDGEGFSFKYSPGKLRGNQYKKMMTKEELEEEQRVQKEQLAAIFKLM
KDNKETFGEMSDGDVQEQLRLYDM
NT seq 615 nt NT seq  +upstreamnt  +downstreamnt
atggaggcgccggccgagctactggccgcgctgcctgcgctggccaccgcgctggccctt
ctgctcgcctggctactggtgcggcgtggggcggccgcgagcccggagcctgcccgcgcg
cccccggaacccgcgcccccggccgaggccaccggggccccggcgccgtcccgcccctgc
gcccccgagccggcggcctcgcccgcggggccggaggagcctggagagcccgcggggctg
ggggagctcggggagcctgcgggaccgggggagcccgaagggccaggggatcccgcggcg
gcgccagcggaggcggaggagcaggcggtggaggcgaggcaggaagaggagcaggacttg
gatggtgagaaggggccatcatcggaagggcctgaggaggaggacggagaaggcttctcc
ttcaaatacagccccgggaagctgaggggaaaccagtacaagaagatgatgaccaaagag
gagctggaggaggagcagagagttcagaaggaacagctggctgccatcttcaagctcatg
aaagacaacaaggagacgtttggcgagatgtccgacggcgacgtgcaggagcagctccgg
ctctacgacatgtag

DBGET integrated database retrieval system