KEGG   Homo sapiens (human): 57061Help
Entry
57061             lncRNA    T01001                                 

Gene name
HYMAI, NCRNA00020
Definition
(RefSeq) hydatidiform mole associated and imprinted
Organism
hsa  Homo sapiens (human)
Disease
H00513  Transient neonatal diabetes mellitus (TNDM)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 57061
OMIM: 606546
HGNC: 5326
Ensembl: ENSG00000283122
Position
6q24.2
NT seq 3815 nt NT seq  +upstreamnt  +downstreamnt
gttagtttggcctattgcagcgtcccagcatctgtcgcgtttctcatgtgtgattgggct
ctggcggcccatcctggcggagacttcggctagcaggccccgctgcagaccccaggccgg
ctcgggtctacctgcgccagcgctgtacctgggcgaccttggctttgcccccaccggtga
cccggcccgcaggacgtgtgggtgccgctcagctccccccgcctcggccgccgaccccca
gctccccggcggggcctcctcctgccacgtgacgcccccgccaggggccccagcgccctc
ctcgcggccgcgccgttccggctcccgagccccgcctgcgcgcggcctcctcggcgcagc
catcctcttggctgccgcgggcggcaaagcccacggcatctgccatttgtcattcagccc
gtcggtaccgccccgagccttgatttagacacggctggggcgtgctctggcctcactctc
cgggcgggtgctggacggacggacggacggggcagccgtgctcacagctcagcagcgcgg
ggccttggcgcgcggggcgcttccccgggtcgccgtcatggccgcggaggtggcacgccc
gagcggcctcgcctgagctccgggggtcgtcgccccgcagggtaggtgtttgggtgctcg
cggctgcggcgggcgggctgggggcagcggtggccgtgcattgccgcgctgcgaggacgg
cgctgggttcgcggccgcgaggagggtgtgcctttgccgcgccgcctacgtgcgggtccg
ggctccgcggggccgggtgcgggaccccgcagatcgtcacccgcaacccaggcagcccca
ccgcgagtgccgccggaccccctggacgccgctgccagaggcgttcgcgcctatctggta
tgaggtccacagacccgattcttacaacctggcgctctaacctcgccaacgggccaggaa
aaaaacagaacaaggaaaagaagaaaaagtctgttccaagtaataatgggactagacagt
aactgtttgcactttcgtctcttatggaaaatatgattattttgatgctttagtattaca
gactgtatcagacatactcttaaaagtatttaaaaacgtggggtcctaaaaatttcctag
atcgggacagctgataatgcgacttctgttagtctccgcatccaactttcagggcggaat
ggggatttctaccttttactgaatatactcctgtaattttgaatattttttctcatcaaa
tgtgttactttcatgttttaggaaaccaataaaaatcaaaaatagaaacacccagcttag
gtcctccttcttccaggaatcctcctctaacccctccctcccaggcaggatcggaggccc
ctcccgggtgctttctggggcctcactgaggtcctggtcccctaagtcctcccccgcagc
ccctccgcgtattaacccaccggtctcgctgggctcagagattgcttacttagcacatgg
taagtgattaatactgtttaatgaccgagggaaaagataaaatgttctctgatgtttcac
gcttttcgctctgaagttaaatagtggtaaatttatatgcgcttagataagaacatttaa
cagttaaggatctggaaaagttgacgacgtccgatgtccgtgtttcctgatccagcagtt
gcacgcctgggtattcatccttaagaacaatgtttttcagaatttgaagtccattttagt
gggtcgtaaagtcatttaaatggatgatcagaatttgtaaaacacagacggagaatagaa
catcagtgtctctcaggtcataggggtgttcgctttatgaatctctctccccctcctcag
tttcatacatacacaaatgtgtgtcatgatgtaaaacgtcattccttagtatgagtcatg
gacaaaaaagtttgaaagccactgccctagataaattttaatacatgtccacaagcagac
gtgtacaagaaggttgactgtaatggcagaaaactggatgccgccttcatgcctacctga
aggagaaagataaattatacaccactcataaaaagggcacactgtacagtggccaatgaa
gtatttttgtgtttcaacacaaatgcctttcagtgttgaaccaaaaaaaaaaaaagttgc
cggagaatgctgtgtgatatcttctatgtaaaattcagaacctggtggagcaaagctgtt
gtttagggatgcatgtataggcattaaaagtagtaaagaaaaaaagtcaagctaatggtc
atctcctagtggggaggagagggtcaggggctcagagatgctggaaatgctttatcgcct
gacctgtgcaatggttacatgggtgtttgctttgtaactctttgttaaatgatacacact
gggtttgaatgttacatttccccccaaatatgttaaaatatgggtgttgcaaactgaaga
agcctgagtctagggctctccgtctgttattcttatttcctggcttctttttagaaaaaa
aaaatcttgctcagggaggagtacctagggaatttatcagtaatgttttatttcataaat
tccatggtggacataccagtattcattaaattattctttatgtattcttataacttaatt
tataatatttcaaaaagcatttaggagaaaacatcatttggtgtgtttgctttcccaaaa
gtcacatttacatgttttgtacacaactggaatattttatatagtaattttagctaaaat
caaattttgttatgaaaaacgaaatactaaaaagtatataaaaatcacagaactttacag
actttcagcgttttaaaatgctaacatattgtatttacctcaataatttctgttcctcag
ttctttcaggccacatttttagtgctcaatagcctcatatgactttaatattttattata
ttttattatgttatatattttacattatacattatagaacagaatatttccatcattgca
gaaatttatattggaaaacattctggatacaaatatttgttatatacttgcagatattaa
actgtagacattaatccttatgctttttgtcttaagatactctactattaatgaaatgta
ttctgaatatttttctaagaatttttaagtttatgttttgtccacattttgttctttaat
ttacctgagacatgtatatattgagatgtatatattttatgttatgagatcaagcttaat
taattttcagattcccacatgaaaaggtaattgtcccaatatcagtgattagcagtgcca
cttctgtcacatacagtacccagatatgtttgggcttatttccaggctgttaatcctggt
ttatttgtcatttgaaaatactgcagattttcatttactgctgctttctatgtagtatat
tgttcagttctaagaatttaagattttttcattgtgatattttttcttcccctaagagat
ttgtagaaagtagtctagttccaatgtggaaggttttgtgagttatccttttgttactga
tttctaatttgcactgtagttagcatacgtgtcaaggccaacaattctttgaaattcgag
aattgctttatggttttaactgctccttgtatcatcaagaataatttgtactcacagact
tttgaggcaatgtatgtaggtgtgtgtatatatataatatatacacatacactttatata
tagattatatataatctctctgtagagtttatataaaaattaaatatatttatataaatg
tatatatatatatgaataaaatctcctgtctctaa

DBGET integrated database retrieval system