KEGG   Homo sapiens (human): 6082Help
Entry
6082              ncRNA     T01001                                 

Gene name
SNORD20, RNU20, U20
Definition
(RefSeq) small nucleolar RNA, C/D box 20
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 6082
OMIM: 604012
HGNC: 10143
Ensembl: ENSG00000207280
Position
2q37.1
NT seq 80 nt NT seq  +upstreamnt  +downstreamnt
tggatatgatgactgattacctgagaaataattgatgaaatctcaagaaaattcctctag
atagtcaagttctgatccag

DBGET integrated database retrieval system