KEGG   Homo sapiens (human): 80161Help
Entry
80161             lncRNA    T01001                                 

Gene name
ASMTL-AS1, ASMTL-AS, ASMTLAS, CXYorf2, NCRNA00105
Definition
(RefSeq) ASMTL antisense RNA 1
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 80161
HGNC: 25811
Position
Xp22.33 and Yp11.2
NT seq 2319 nt NT seq  +upstreamnt  +downstreamnt
ttgttttcttttatttatttatttagacggagtctcactctgtcgcccaggctggagttg
cagtgagccgagattgcattattgtactccagtctgggtaagaagagctaaactccagag
tctgtctcagaaaaaggaaaacagctgaaatataggagactgacgcccagcccaggaaca
ggtaagctgggtgcacgcgccgtgaaaacagcacctaggcctgctccggttctcgctttg
cagatgcctcctgaacctcagtgcctcctaaggtcaaggctgtgagttaaagggctccac
cccagcccagccccaggttggcccagccattccctggtggaggggccagggaggaaaggg
ggctgtgtgggcaccagagggtgaactgaggtctgagggtcgggacacaggccgggaaca
gcagctgggagcggagcacgggggaaacgtggatgcgctgagctccctacaaccgcagtg
agcatgtgcccaggagggcctcacggggtgggtgtgagtctggcctgcctgggctcgggg
tggggggtgtttacagacgcatttcagccccgcagcaggggctggggaggtcccgctcgt
gacagtctctgcaccaaggcaggagagatggaagccgcccagagaactgccactccatag
cctgtgggcatccaggggtgagcggcagcgatggcgccccatggaggaaacacactggaa
atcgtgcagaagatgggaagatgcaggctggagtgcggagaaggactgagaccctgcctg
gtagacggcaccgtcacagcagccgtctgcctgctaggaggagcgtctccaccagcagca
ggccggcccctgagggagacagcagagagctggagtcctggccagccaggcggggatcct
tcagcaggacacaggggacacagcaggcaacaggagctcagaacgctctcggcgaccctg
ctgagtaacttgtggactttgtcgtctggccagtcatgcaggatccggcacaggacgtac
agctcagcgctggggagggggtccctgaaaaagtcacctggtttaaagacaaaacgagat
acgtccgtcagagacagaagaggagacagacacagaggagaaggccacgtggagacggag
gcagagactggagtgatgcggccacaagcccagggacgcctggagcccccaggagctgga
agaggcgggaaggatcctcccctagagcctctcagaaagaatcaaacacaactgcaatgg
gttgggtggtgacgtccaaaagatctgtccaagtcctaagccccagaacctgggaatggg
acctcatttggataaagtttctttgcagatgtaattaaggatctggagatgggatcatcc
tggagtagggtgggccctaaatgcaatggcaggtgtccttctaagagacagaagaggaga
cacacagaggagaaggccacgtggagatggaggcagagactggagtgatgcggctacaag
cccagggacacccggagcccccaggagctgggagaggcaggaaggatcctcccctagagc
ctccagagggagcacagccctgagatgccttgatctcagacctccggtctgcaggacagg
gagaggataaatagcaagctatctggcaaatcagaagcacagctatcatgatgtcctgca
ggaggagctgtagggtggttgcgttttgtttttttaaaaacgagaaaagcatccaggaac
ctctgggggagggttgtggaggtccccagcacctgtgcccacaggcctggccgctgtcgg
atggtgctgagttacagcacgtcagctgtctctttttttatttttttattttttttgaga
tggagttttgctgtgttgcccaggctggagtgcagtggcgcgatctcggctcacggcaag
ctccgcctcccgggttcaagcgattctcctgcctcagcctcctgaataggtgggattata
ggcacccgccaccatgcctggctaatttctgtaattttagtagagatggggtttcaccat
gttgctctggctggtctcaaactcctgacctcaggtgatccacccgcctcagcctcccag
agggctgggattccaggcgtctcctgtcaatccgtcctggcctcagcagctgccacctgg
aagttctccttcaagtctaacctaaggccacactgtgacggctctcgggtcagttccttc
cgtgacctcggcaccgtggatgcccatgaatgctgatctcggctgttccccatctccact
cccctcacgtctcggctacttgcactgatgataacttca

DBGET integrated database retrieval system