KEGG   Homo sapiens (human): 9069Help
Entry
9069              CDS       T01001                                 

Gene name
CLDN12
Definition
(RefSeq) claudin 12
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 9069
NCBI-ProteinID: NP_001172001
OMIM: 611232
HGNC: 2034
Ensembl: ENSG00000157224
Vega: OTTHUMG00000156612
Pharos: P56749(Tbio)
UniProt: P56749 B2R687
Position
7q21.13
AA seq 244 aa AA seqDB search
MGCRDVHAATVLSFLCGIASVAGLFAGTLLPNWRKLRLITFNRNEKNLTVYTGLWVKCAR
YDGSSDCLMYDTTWYSSVDQLDLRVLQFALPLSMLIAMGALLLCLIGMCNTAFRSSVPNI
KLAKCLVNSAGCHLVAGLLFFLAGTVSLSPSIWVIFYNIHLNKKFEPVFSFDYAVYVTIA
SAGGLFMTSLILFIWYCTCKSLPSPFWQPLYSHPPSMHTYSQPYSARSRLSAIEIDIPVV
SHTT
NT seq 735 nt NT seq  +upstreamnt  +downstreamnt
atgggctgtcgggatgtccacgcagccacagtcctttccttcctgtgtggaatcgcctca
gtagcaggcctctttgcagggactctgcttcccaactggagaaaattacgattgatcaca
ttcaacagaaacgagaagaacctgactgtttacacaggcctgtgggtgaaatgtgcccgg
tatgacgggagcagtgactgcctgatgtacgacactacttggtactcatcagttgaccag
ctggacctgcgtgtcctccagtttgccctacccctcagcatgctgatcgccatgggtgcc
ctgctgctctgcctgattggaatgtgcaacactgccttcaggtcctcggtgcccaacatc
aaactggccaagtgtctggtcaatagtgcaggttgccacctggtggctgggctgctattt
ttcctggcaggtactgtgagcctctccccatctatctgggtcatcttttataacatccat
ctgaacaagaagtttgagccagtcttttcatttgactatgcagtgtatgtcactattgct
agtgctgggggcctgtttatgacttcccttatactatttatttggtattgtacatgcaaa
tctttgccttctcctttctggcaaccattgtactcccatccacccagtatgcatacttac
tcacagccctattcagcacgctctcgcctctctgccattgaaattgacattccagtagtt
tcacacaccacttaa

DBGET integrated database retrieval system