KEGG   Homo sapiens (human): 100129239Help
Entry
100129239         CDS       T01001                                 

Gene name
CXorf51A, CXorf51, CXorf51B
Definition
(RefSeq) chromosome X open reading frame 51A
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 100129239
NCBI-ProteinID: NP_001137536
HGNC: 30533
Ensembl: ENSG00000224440
Vega: OTTHUMG00000022600
UniProt: A0A1B0GTR3 P0DPH9
Position
Xq27.3
AA seq 108 aa AA seqDB search
MAKVTSEPQKPNEDVDEQTPSTSSTKGRKKGKTPRQRRSRSGVKGLKTTRKAKRPLRGSS
SQKAGETNTPAGKPKKARGPILRGRYHRLKEKMKKEEADKEQSETSVL
NT seq 327 nt NT seq  +upstreamnt  +downstreamnt
atggcaaaggtgaccagtgagccacagaagcctaatgaagatgtggacgaacagacccca
tcaacctcaagtaccaaagggaggaagaaggggaagacaccccgtcaacgaaggtccaga
agcggcgttaagggcctaaagaccaccaggaaggcgaaaagaccccttcgagggagctcg
agccaaaaagccggtgaaactaacacccctgcaggaaaacctaagaaagctagaggacca
atactgcgtggtcgttatcaccggctgaaagaaaaaatgaagaaagaagaggccgacaaa
gagcaaagcgagacctcagttctgtga

DBGET integrated database retrieval system