KEGG   Homo sapiens (human): 100170229Help
Entry
100170229         CDS       T01001                                 

Gene name
SRRM5, ZNF576
Definition
(RefSeq) serine/arginine repetitive matrix 5
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 100170229
NCBI-ProteinID: NP_001139113
HGNC: 37248
Ensembl: ENSG00000226763
Vega: OTTHUMG00000165480
Pharos: B3KS81(Tdark)
UniProt: B3KS81 Q4G0Z0
Position
19q13.31
AA seq 715 aa AA seqDB search
MSSPKRSSKPSMSLAPSGSSMPTADPKPPASLKSTKSATPNRSLVPTKPATSRNSVMSPS
SSKSTKSTSTKRAPSNRPSSRSRVRSKARTPSRVSTDTRTSKASKASDVRCHQRRGTHSR
GRTPGRRGSRSSKRSPSRASTPGRIRTHGARPGMASRVRTPTSQQKGSRGKSYGRPRTSN
RERSDSQPRNLSKKSYRPPGGSGIGRSSELAVTPSTAKCQTPTGIPSKEKSDNPSPSSSR
KVKSYGQMIIPSREKSYSPTEMSSRVKSYNQASTRSRPQSHSQSRSPRRSRSGSQKRTHS
RVRSHSWKRNHSRARSRTRKGILSQMGRHSQSRSHSKGKSQNQSRTPRRGRSHNWSRNPS
KERSHSHSRSSSKERDHRGSSSPRKESGRSQSGSPNKQRDHSRSRSPNKARDRSRSRSPY
KARDRSRSRSPNKARDCSRSRSPYKARDRSRSRSPNKARDHSRSRSPNKARDRSRSRSPS
KERDHSQLGSPSKERDHRRSRSPSKERQCRQSRSSSKERDHRRSRSPSKERQRRQSRSPN
KERDRSQSRSPSEEREHRQSRSPSKERDRRRWRSPSKERERRQSRSSSEERDHSRSRSPN
KQSGYSRPRASSKEKAHSRSRTPSKEGNHSQSRTSSKESDPSQSTVPRSPDWKRSPTRTS
SLSQNRTPSKTSSHSPSTFPSGGQTLSQDDSQADATTSKATLPGERSSSSSSKLA
NT seq 2148 nt NT seq  +upstreamnt  +downstreamnt
atgtcttcacctaagagatcttcaaagcccagtatgtctctggcacccagtggatcctcc
atgcccactgcggatcccaagcctcctgcctccttgaagtccaccaaatcagcaacaccc
aacagatccttagtgcccaccaaaccagcgacatcccgtaactcagtcatgagcccaagc
agttccaagtccaccaaatcgaccagtacaaaaagagccccttctaaccggcccagcagc
aggtcccgagtccgcagcaaagcaagaacacccagcagggtgagcaccgacaccaggacc
agcaaagccagcaaggccagcgacgtgagatgccaccagcggaggggcacacacagccgg
ggtaggacacctggcagaaggggaagccgcagctccaagaggtcacccagcagggccagc
actcctggcaggataagaactcatggtgccagaccaggcatggccagcagggtgagaact
cccacttcacagcaaaaagggagccggggaaagagttacggccggcctagaaccagcaac
agggaaaggagtgacagccagcctagaaatctgagcaagaagagttaccgcccaccagga
ggctcaggtatagggaggagttccgagctggctgtaactcccagtacagccaagtgtcaa
accccgactggaattccctccaaggagaagagtgacaacccatctccatcctcatcaagg
aaggtgaagagctacggtcagatgatcatccccagtagggaaaagagttacagccccact
gaaatgtccagcagggtcaagagttataaccaggccagcacccgcagcaggccgcaaagt
cacagccaatctagaagccccagaaggtcaagaagtggcagtcagaagaggacgcacagc
agagtgagaagtcacagttggaagagaaaccatagcagggcaagaagtcgcacccggaag
ggaattctgagccagatgggaagacacagccagtctagaagccacagcaaggggaaaagt
caaaaccaatctagaacccccagaagaggaagaagtcacaactggtctagaaaccccagc
aaggaaagaagtcatagccattccagaagctccagcaaagagagagatcacaggggatct
agcagccccaggaaggagagtggtcgcagtcaatcaggaagccccaacaagcagagagat
cacagccgatctagaagtcccaacaaggcgagagatcgcagccgatctagaagtccctac
aaggcgagagatcgcagccgatctagaagtcccaacaaggcgagagattgcagccgatct
agaagtccctacaaggcgagagatcgcagccgatctagaagtcccaacaaggcaagagat
catagccgatctagaagtcccaacaaggcgagagatcgcagccgatctagaagccccagc
aaggaaagagatcacagccaacttggaagccccagcaaagagagagatcacagacgatct
agaagccccagcaaggagagacagtgcagacaatctagaagctccagcaaagagagagat
cacagacgatctagaagccccagcaaggagagacagcgcagacaatctagaagccccaac
aaggagagagatcgcagccaatctagaagccccagcgaggagagagagcacagacaatcc
agaagccccagcaaagagagagatcgcagacgatggagaagccccagcaaggagagagag
cgcagacaatctagaagctccagcgaggagagagatcacagccgatctagaagccccaat
aagcagagtggttacagtcgacctagagcctccagcaaggagaaagctcatagccgatct
agaacccccagcaaagaaggaaatcatagccaatctagaacctctagcaaggagagcgac
cccagtcaatctacagtccccagaagtcccgactggaagagatcccctactaggacaagc
agtctcagtcagaatagaacccctagcaagacaagcagccactccccatcaacatttccc
agtgggggccaaaccctaagccaggatgacagtcaagccgacgccaccacctctaaggcc
accttacctggggaaaggtcttcatcatcttcttccaagctggcgtag

DBGET integrated database retrieval system