KEGG   Homo sapiens (human): 102723547Help
Entry
102723547         CDS       T01001                                 

Gene name
CSAG2, CSAG3, CSAG3B, CT24.2, TRAG-3, TRAG3
Definition
(RefSeq) CSAG family member 2
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 102723547
NCBI-ProteinID: XP_006724920
HGNC: 16847
Ensembl: ENSG00000268902
UniProt: A0A1W2PPV0
Position
Xq28
AA seq 127 aa AA seqDB search
MWMGLIQLVEGVKRKDQGFLEKEFYHKTNIKMRCEFLACWPAFTVLGEAWRDQVDWSRLL
RDTGLVKMSRKPRASSPLSNNHPPTPKRRGSGRHPLNPGPEALSKFPRQPGREKGPIKEV
PGTKGSP
NT seq 384 nt NT seq  +upstreamnt  +downstreamnt
atgtggatgggcctcatccaattagttgaaggtgttaagagaaaagaccaaggtttcctg
gaaaaggaattctaccacaagactaacataaaaatgcgctgtgagtttctagcctgctgg
cctgccttcactgtcctgggggaggcttggagagaccaggtggactggagtagactgttg
agagacactggtctggtgaagatgtccaggaaaccacgagcctccagcccattgtccaac
aaccacccaccaacaccaaagaggcgaggaagtggaaggcatcctctcaaccctggccca
gaagccctatcaaagttcccaagacaacccggaagggaaaagggacccatcaaggaagtt
ccaggaacaaaaggctctccctaa

DBGET integrated database retrieval system