KEGG   Homo sapiens (human): 118430Help
Entry
118430            CDS       T01001                                 

Gene name
MUCL1, SBEM
Definition
(RefSeq) mucin like 1
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 118430
NCBI-ProteinID: NP_477521
OMIM: 610857
HGNC: 30588
Ensembl: ENSG00000172551
Vega: OTTHUMG00000169815
Pharos: Q96DR8(Tbio)
UniProt: Q96DR8
Position
12q13.2
AA seq 90 aa AA seqDB search
MKFLAVLVLLGVSIFLVSAQNPTTAAPADTYPATGPADDEAPDAETTAAATTATTAAPTT
ATTAASTTARKDIPVLPKWVGDLPNGRVCP
NT seq 273 nt NT seq  +upstreamnt  +downstreamnt
atgaagttcttagcagtcctggtactcttgggagtttccatctttctggtctctgcccag
aatccgacaacagctgctccagctgacacgtatccagctactggtcctgctgatgatgaa
gcccctgatgctgaaaccactgctgctgcaaccactgcaaccactgctgctcctaccact
gcaaccaccgctgcttctaccactgctcgtaaagacattccagttttacccaaatgggtt
ggggatctcccgaatggtagagtgtgtccctga

DBGET integrated database retrieval system