KEGG   Homo sapiens (human): 130540Help
Entry
130540            CDS       T01001                                 

Gene name
FLACC1, ALS2CR12
Definition
(RefSeq) flagellum associated containing coiled-coil domains 1
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 130540
NCBI-ProteinID: NP_631902
HGNC: 14439
Ensembl: ENSG00000155749
Vega: OTTHUMG00000132824
Pharos: Q96Q35(Tdark)
UniProt: Q96Q35
Position
2q33.1
AA seq 445 aa AA seqDB search
MYPNPLIYCTCWDPWNLGPRKLIKTPQLPRKNSTGSSKLTPLVPAPKNHNYLQPTKPVVS
PKMKIHSARQEETNKSFYEVINVSPGYQLVRNREQISVTLGDEMFDRKKRWESEIPDKGR
FSRTNIISDLEEQISELTAIIEQMNRDHQSAQKLLSSEMDLRCAEMKQNFENKNRELKEA
HEAELSELENNYKAALKAEKLAAQEKLEEMGKEYKYLKNMFRTYQDSIYDEMEEKWSKQK
AKWKKDEKFERENILLQQKKKMTKKFEMESGEEDKKINESCSAVFENFIQEKEELLKQHQ
SDTLQLEELRKTKEVPWRRDQINRHWHDVLQQLLLMQVMQEELHAQALILESLNTNLYYT
QLELQKEKAIVGNLEKMLQTKFAETEEKYKHTIQILTEENIHLKQKIISKNEEICEGCSG
RLASITVSKDDSDTVQDGSKKGQES
NT seq 1338 nt NT seq  +upstreamnt  +downstreamnt
atgtaccccaaccctctcatctactgcacctgctgggacccctggaacttgggaccacgg
aagctaatcaagacccctcaactaccacgcaagaactccacagggagttccaagctaact
cctcttgtaccagctccaaaaaatcacaattacctccaaccaacaaaacctgttgtttcc
ccaaaaatgaaaatccattcagcaaggcaagaagagactaataaatcattttatgaagtg
atcaacgtgtcacctggctatcaacttgttcggaatcgggaacagatttctgtcacctta
ggggatgagatgtttgataggaaaaagcggtgggaatcggagatcccggacaaaggcaga
ttttccaggaccaacatcatttctgacctagaagagcaaatctcagagctgacagcaata
attgaacaaatgaacagagaccaccagtctgcccagaaattgctctccagtgaaatggat
ctccgctgtgctgagatgaaacagaactttgaaaacaagaacagggagctcaaagaggcc
catgaagcagaactcagtgagttggagaacaactacaaagcagccttgaaggcagagaag
ttggctgcccaagagaagctagaggagatgggaaaagaatacaagtatttgaagaatatg
tttcgtacgtatcaggacagtatttatgatgaaatggaagagaagtggtcaaaacagaag
gcgaaatggaagaaggatgagaagttcgagcgagaaaatatcctgctacagcaaaaaaaa
aagatgaccaaaaaattcgaaatggagtcaggagaagaagataagaaaataaatgaatcc
tgcagtgctgtctttgagaacttcattcaagagaaggaggagctcttgaaacaacatcaa
agtgacaccttgcaattagaagagctgagaaaaaccaaagaggtgccctggagaagagac
caaataaatagacattggcatgatgtcctgcaacagcttcttcttatgcaggtcatgcag
gaagaattgcatgcacaagcccttatcctagagtcactgaacacaaacctctactatacc
cagttggaactccagaaagagaaagctatagtgggaaatctggagaaaatgcttcaaacc
aagtttgctgaaactgaagaaaagtataagcacaccatacagatcctgacggaagagaac
attcatctgaagcaaaagataatttctaagaatgaagaaatttgtgaaggatgttctggg
agattggcctctattactgtttctaaggatgattctgacactgtgcaagatggtagcaag
aaaggacaagaatcataa

DBGET integrated database retrieval system