KEGG   Homo sapiens (human): 153571Help
Entry
153571            CDS       T01001                                 

Gene name
C5orf38, CEI, IRX2NB
Definition
(RefSeq) chromosome 5 open reading frame 38
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 153571
NCBI-ProteinID: NP_848664
OMIM: 610522
HGNC: 24226
Ensembl: ENSG00000186493
Vega: OTTHUMG00000161741
Pharos: Q86SI9(Tdark)
UniProt: Q86SI9
Position
5p15.33
AA seq 138 aa AA seqDB search
MVAPAARVFLRAVRAALTSTVPDLLCLLARGSPRGLASGRLPLAVHSAQHGPGSGAPWLR
IARRALRFVLSKHWGDDCYLTNRLWQDLKPPSHVENGQELRLAPPVQWALQVQGNQLQTA
VLCLRMAPPEPAGSRQRI
NT seq 417 nt NT seq  +upstreamnt  +downstreamnt
atggtggcgcccgcggctcgggtcttcctccgggcagtgcgcgcggctctcacttccacg
gtcccggacctgctctgcctcctggcccgaggctccccgcgtggcctcgcgtctggtcgc
ctacccctcgcggtccactccgcccagcatggacctggatccggggcgccttggttgcga
attgccaggagggccctgagatttgtgttgtcaaaacactggggggatgattgttacctg
acaaaccgcctctggcaggacctgaagcctcccagtcacgtcgagaacgggcaggagctc
aggttggcgccgccggtgcagtgggcattacaggtgcaagggaaccagttgcaaactgca
gtgctgtgcttgaggatggctcctcctgagccggcaggctcccgccaaagaatttag

DBGET integrated database retrieval system