KEGG   Homo sapiens (human): 157627Help
Entry
157627            lncRNA    T01001                                 

Gene name
LINC00599, Rncr3
Definition
(RefSeq) long intergenic non-protein coding RNA 599
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 157627
HGNC: 27231
Ensembl: ENSG00000253230
Position
8p23.1
NT seq 2942 nt NT seq  +upstreamnt  +downstreamnt
cgccctccgcagacctccgcgcagcggccgcgggcgcgaggggaggggtctggagctccc
tccggctgcctgtcccgcaccggagcccgtggggtggggaggtgtgcagcctgtgacaga
caggggcttagagatgcaaacagactcagggagagaaacagaagctgattctgtgacaga
agcagatctgtgcagcacagatgcggtgtgcgtggggagggggtcgcctgggagcgcatt
gcggagtgcttgtgtgtgcagatttttctctgggctcaggactcattgtatgtgggtcaa
caccttcctccgtgactgtgtttttgttctgagctgagttttttggtttgcccttaaaaa
aataataatttggcatccagagactggcagactgcctcagggcctggactgcggatatat
tgtgttctgcttgaggtttggggaggagggcaggcggtaggaagggagagggggagctgt
ttgtcacactttgctgtagagctgagagcacctgacaagcttaaggaagtcgttgggcta
tgtggacaagaaggagccagctcccagcgggttcacaagctctatcggagttgaaagcgt
ggtcatggctctaaggagcacctcacgccctccctgtagctgttattgcagtttcaggca
gagatccaggagctgcagaggaagggagaggcacaataacctacatggacccaagggaga
catgtgttcctttaaaaatgtgaacagaaggaaaaacagaatgtgtgcaactgggggtct
gaggaaagactgttttgaaagaggctgtcagggaatggaaagggttaagcttttcatcct
gaagaacctgcttcccaaatcaggccttcctcccatcactagaccctgagcagcagctgg
tcctagagacccccctcgtactgcgctgccacagtctcatcccatttccagctctgtatt
aaccaccaagctgcagcggatggggcaagacctaagctcattaatttccaggtggaggaa
atggaggaggggcaggtccctgcagtagagggaggagcagagaaaggaggccaagagctg
gatccttctgcccaggaagcctgctgcatcccttcccccgagcatggcagaggcctggct
ttgcaaggccaaggccataagggatgcttaggagattaatttgattcctgacacaataat
caagccctaagagtctccactgaagcttactgaggacttctttcctctccaaagcctcag
tctagcctgctaaataaattagtattcagtgatgccttggatcagggcccctccccggcc
tcagtttccccaaatatttattaagtacctactgtgtgcaatccttgtgtaattattacc
tcttaggctcttcatttgccctcctaaagcagtgtttagagtcaggcagaggttaagtgt
gttgcacctcacctagatacttccagaaccttctctgggtctgcagaatgtggcacaacc
tgcttgcccccgcagagagaaagctgcagtgcacatcctgcagactgcaggtgctgggct
gcctctggagtcccagaaggcaagcttggctgcaggacagaaagggagaacagcttctct
cacccctgagccttcacaagcccttgtctatttgccgttgccttcaaaatatacctcccc
cgaaaccagtagctttctgagtcctggtgtcccctccgccctttctggacaggtttggga
agaagaaagcagtcagtgctgggccttattggggtgtgaagcgccttgctctgccccttc
tgctcactgtgaaggccgctggatgcttctcttaggcatggtttaagcctccgattacta
aaccccttgccccacaaacgtccacattgacgagcctctttttagtaactgcttccccgt
aattccttcagaggttgctgtacccttcgctgatgtgctgccctcctgtaaaacctccag
atgccttcccacgtaatgcccctttcagatgctttaagctgagagcttaaaccacaggta
ccatggctgacgcctgccaggtttctgctgcagataatctatgatgggaggggcatattt
tttacttcattacttatgtaaactcttgttccagaaagctttaatgtgtgtgggagtgtt
ctgggtctattaggtctgtgcgcatgggtgtgggcatttgcctgtgtccaccgggtgggt
ctcattatgaaatgtatgtttatgtagggctttaatggctgaaaatggcaaagagatgaa
tagaccacttggccccatgtgtaattgccaggccccttctgtgctcaaatgaggtgtccg
agtgaaggtcagcccttcccttctgtatttggggcctatttatgccaccagtaattttat
aagaaatctgaatagttctcccctttgagtgcatttaactctttagtatcttctctctta
cctatttgagcccctctagctacagtctggcttaaatgaaaggggaattatatgcttaag
aaaaagtaggacacggttgaggcagtttgctgactgaatacgcgaagaaggacctgatgg
gctcatatgcaccactgccatcacagtccccatcgtgatgcaagcttatatgattcttga
gaaacagcccagatctcctcttaagcggaaaagagattgaccttctagcagaggcaaaga
atggagtcttctgggggcagctgcaaagcgttctccctaggacagatggagcctcccttt
cctcatctactctgtgggtggtttcagggcccacgagtcaacatgaggagttgtgctggt
ggtatgtgtgttggaggctgggctggctgattcacagtgacgaggatgtcaataataaca
agaatgagaatgatggtacctaataaagactttttttcccaaaaaaaaaaaaaaaaaaaa
aa

DBGET integrated database retrieval system