KEGG   Homo sapiens (human): 158511
Entry
158511            CDS       T01001                                 
Symbol
CSAG1, CSAGE, CT24.1
Name
(RefSeq) chondrosarcoma associated gene 1
Organism
hsa  Homo sapiens (human)
SSDB
Other DBs
NCBI-GeneID: 158511
NCBI-ProteinID: NP_001096046
OMIM: 300944
HGNC: 24294
Ensembl: ENSG00000198930
Pharos: Q6PB30(Tdark)
UniProt: Q6PB30
Position
X:complement(152727484..152733721)
AA seq 78 aa
MSATTACWPAFTVLGEARGDQVDWSRLYRDTGLVKMSRKPRASSPFSNNHPSTPKRFPRQ
PRREKGPVKEVPGTKGSP
NT seq 237 nt   +upstreamnt  +downstreamnt
atgtcggcgactacagcctgctggcctgccttcactgtcctgggggaagctcggggagac
caggtggactggagtagactgtacagagacactggtctggtgaagatgtccaggaaacca
cgagcctccagcccattttccaacaaccacccatcaacaccaaagaggttcccaagacaa
cccagaagggaaaagggacccgtcaaggaagttccaggaacaaaaggctctccctaa

DBGET integrated database retrieval system