KEGG   Homo sapiens (human): 1587Help
Entry
1587              misc_RNA  T01001                                 

Gene name
ADAM3A, ADAM3, CYRN1, tMDCI
Definition
(RefSeq) ADAM metallopeptidase domain 3A (pseudogene)
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 1587
HGNC: 209
Ensembl: ENSG00000197475
Position
8p11.22
NT seq 2434 nt NT seq  +upstreamnt  +downstreamnt
gtgggtgggcgcgcggggctgtaggatccacccgcctcgggatccacggagctgggtccc
cgccgcgccccgcggaccccacggcccttccgctccgctcggcctccaccaccctggcct
cgagctgcagccgttccaaggacaacggccatccctgtggctgggccgccggctacgcaa
tgctgtctctcttgctgatcctctcaggcctgggccggctgacctccgcgggcccacgcc
acttattccatcaaaattgaggggaaaccatacacttcctgcttgaaaaacagtcatttt
tacacccacatttcctggtgtatttatacaacaaatcaggaacattgtatgcagattctt
cattttcaaagggtcattgcttttaccaaggatatgctgcagacattccaaaatcagttg
tggcactacgcacctgttctggactcagaggattactgcagttagataatatcagttatg
gtattgaaccattggaatcttcacctacatataagcatgtagtttatcgaattaaaaatg
atgctattggtcattcctcctttcaagaaaattatcctgtggctcaatatatagatcagt
cctacaggattcttgtcaaatcagacataaattcaggtgccatgctatcgaaaagaactc
tgaaaatacaaatcattatggataaagccatgtatgcttatatgggctccacggtggcag
ttgcagttgagaaagttttccaaatctttggtcttatcaacactatgttttcccagctta
atatgacagttatgctgtcttccttggagatctggtcagatcaaaataagatttcaacaa
gtggtcatgctgatgaaatactacagcgatttttgccttggaaacaaaaatttttgtttc
aaaggtctcatgatatgacatacttattaatttataggaaccattctacttatgtgggag
caacatatcacggaatggcatgcgatccaaagtttgcaacaggaattgctctgtatccaa
agaaaatcactgcagaggccttttcagttgttatggcacagttgcttggaattaatctgg
gattgacatatgatgatatctacaattgttactgtccaggaactacatgcataatgaatc
ctgatgcgatatgatcccatggtatgaagttttttagcagttgcagcatggatggattta
aacggatagttctgcagcctgaacttaaatgttttcaggataaaacagtttcaaaaatga
cttaccgaaaatcttcaacttgtggcaatggaattttggaacctacagagcagtgtgatt
gtggctataaagaggcatgcactcataaaaaatgctgtaatcctgcagattgtactctag
ttagatctgcagaatgtggcactggatcatgctgtaacaataaaacttgtacgatccacg
aaagaggccatgtctgcagaaaaagtgtagatatgtgtgattttccagaatattgcaatg
gaacatctgagttttgtgtacctgatgtgaaagctgctgatttagaatactgcagtaata
agactagctattgctttaaaggagtatgcagagaaagggatagacagtgttcacagttat
ttggaaaatttgctaagtctgctaatcttctgtgtacagaagaagtgaattttcaaaatg
acaaatttggaaactgtggttcccgttgtgatttttttgatatcctttgtggaaagattg
tttgtcactggatacattcagaactagtaccaatgacagacttagacatacaatatactt
accttagaggtcacgtatgtttgtccgcacatgcaagaaatggttcaaaacaatcggaga
cctatacagaagatataactgcatgtggccaacacaaggtatgtcactcccgagaatgca
gaaattttagtgaactaaatataacaaaatatactacaaattgtggacagaatgggattt
gcaatgaacatttccattgtcaatgtgatcctggttatgctcctccagattgtgagccag
caatgtcatcaccaggaggaagtatcaatgatggattttggcttacagtagaaaaaagtg
tacccttgcttccaaaacgacgtgctgctcctaaaaacaatggtcttttgatcagtttct
acattttttcacctttgctcattttaattgctattgttagtcttaaatggaataaaatga
agagatttcggagcaaagtgggaacagtaagcagcagatctatctcagaagacagcggta
gtaacagcagccagtcacagagttaaagtaaccaagtgataaaatcaaagccatcggatg
aagaaaggatattaccaagaaactcaccattaacttaaaactttcaacttcacagaaaaa
aataaatcatatgactaaaagcataaaaaaaaaa

DBGET integrated database retrieval system